View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_low_19 (Length: 344)
Name: NF20675_low_19
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 343
Target Start/End: Complemental strand, 29089557 - 29089226
Alignment:
| Q |
2 |
tttctctttctctttctctttctatgtctgaacagaacattaagaagaacataacataagaaaacaggttagacagagtgtaagagtggttgttctcttc |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29089557 |
tttctctttctctttctctttgtatgtctgaacagaacattaagaagaacataacataagaaaacaggttagacagagtgtaagagtggttgttctcttc |
29089458 |
T |
|
| Q |
102 |
tcttccttttatggttgcatttgtttattgagaatgagaatgagaatgagagtgagagtgaatctatctatctgtttactattatttcacttcgtaggtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29089457 |
tcttccttttatggttgcatttgtttattgagaatgagaat------gagagtgagagtgaatctatctatctgt------ttatttcacttcgtaggtt |
29089370 |
T |
|
| Q |
202 |
gtgcattttgcagtga--nnnnnnnnnnnnnnnnactgaagaaacaagcatgtaagtaaaactcatcatgtgcacgtgtacacccacatcacatgctttt |
299 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29089369 |
gtgcattttgcagtgactctctctctctctctctactgaagaaacaagcatgtaagtaaaactcatcatgtgcacgtgtacacccacatcacatgctttt |
29089270 |
T |
|
| Q |
300 |
tcctctttttgtgtcaaaacctattattaccacatgctcttctt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29089269 |
tcctctttttgtgtcaaaacctattattaccacatgctcttctt |
29089226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University