View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_low_44 (Length: 238)
Name: NF20675_low_44
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 41 - 221
Target Start/End: Complemental strand, 5612980 - 5612800
Alignment:
| Q |
41 |
tacacatcaactaaaaatgtagctcttcagtctctcttacccgacattctttgtctcatctatctttcaagtttgaaatgtttcatttgaagcatattta |
140 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5612980 |
tacacatcgactaaaaatgtagctcttcagtctctcttactcgacattcttcgtctcatctatctttcaagtttgaaatgtttcatttgaagcatattta |
5612881 |
T |
 |
| Q |
141 |
aatggaggttaattcttatgttggtttctttgccaactttgatcaccacagttttttctcttagacgattcttcaatcttc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5612880 |
aatggaggttaattcttatgttggtttctttgccaactttgatcaccacagttttttctcttagacgattcttcaatcttc |
5612800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 5613113 - 5613071
Alignment:
| Q |
1 |
caatagacaattaatagattgaaattacatagatttaaattac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5613113 |
caatagacaattaatagattgaaattacatagatttaaattac |
5613071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University