View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20675_low_47 (Length: 201)

Name: NF20675_low_47
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20675_low_47
NF20675_low_47
[»] chr3 (1 HSPs)
chr3 (20-187)||(31060241-31060408)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 31060241 - 31060408
Alignment:
20 attttttgtggctaaccctctagttccaaggtgacgagtgtgttagtaattcggagttcgatcagaagataagtaaaatctaaccttaaattgcttcgct 119  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||    
31060241 attttttgtggctaaccctctagttccaaggtgacgagtgtcttagtaattcggagttcaattagaagataagtaaaatctaaccttaaattgcttcgct 31060340  T
120 cataaatcaaacttgagttctctcgaacgattcgtcctaacggctcattaaccactttacagtataat 187  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||    
31060341 cataaatcaaacttcagttctctcgaacgattcgtcctaacggctcattaaccactttccaatataat 31060408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University