View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20677_high_5 (Length: 258)
Name: NF20677_high_5
Description: NF20677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20677_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 12513498 - 12513277
Alignment:
| Q |
14 |
cacacactctcattcaagaatccccgggggttgaagcacggactgcttgcccaccctacagctttttgaaatttatcttttatttagaagaataggagta |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12513498 |
cacacactcttattcaagaatccccgggggttgaagcaaggactgcttgcccaccctacagttttttgaaatttatcttttatttagaagaataggagta |
12513399 |
T |
 |
| Q |
114 |
acaaggatgaaactctagaccacaatgtttgagaagctttcatatcatgttatatgaactaccccaaaatcttaagttgttgggtaaaagcttgtaaatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12513398 |
acaaggatgaaactctagaccacaatgtttgagaagctttcatatcatgttatatgaactaccccaaaatcttaagttgttgggtaaaagcttgtaaatg |
12513299 |
T |
 |
| Q |
214 |
attttattatatataagaaaga |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12513298 |
attttattatatataagaaaga |
12513277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University