View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20677_high_6 (Length: 224)
Name: NF20677_high_6
Description: NF20677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20677_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 30165156 - 30164972
Alignment:
| Q |
19 |
tgaattaattgatgaacacatttcgttgttctcgtaagtgtattgctcgtaacattgagcatttctcttttttgaaatatttaaataaaaaatatagcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30165156 |
tgaattaattgatgaacacatttcgttgttttcgtcagtgtattgctcgtaatattgaacatttctcttttttgaaatatttaaataaaaaatatagcat |
30165057 |
T |
 |
| Q |
119 |
acgtagaacatgtaattttccc------ctaaaacatgcaattttcattcactttcttttaaattaaac-aaaaaacacaaggtt |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30165056 |
acgtagaacatgtaatattccctaaaaaaaaaaacatgcaattttcattcactttcttttaaattaaacaaaaaaacacaaggtt |
30164972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University