View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20677_low_4 (Length: 271)
Name: NF20677_low_4
Description: NF20677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20677_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 256
Target Start/End: Complemental strand, 36852069 - 36851823
Alignment:
| Q |
10 |
ttatactccttgttccatccctttctgtttttagtaatttatttaatgttttaaataaatctctttgcaaatgtgccaaacatttaattaannnnnnnca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36852069 |
ttatactccttgttccatccctttctgtttttagtaatttatttaatgttttaaataaatctctttgcaaatgtgccaaacatttaattaatttttttca |
36851970 |
T |
 |
| Q |
110 |
tggggaaaatttggttagctctggaaacttgtggaaggaagattgtgcctaccgcaatcaccaactgccagtgataataacaataacaatggataataaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36851969 |
tggggaaaatttggttagctctggaaacttgtggaaggaagattgtgcctaccacaatcaccaactgccagtgataataacaataacaatggataataaa |
36851870 |
T |
 |
| Q |
210 |
acaactaataaaatgctgccacgtggcagataggattccatgttact |
256 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36851869 |
acaactaataaaatactgccacgtggcagataggattccatgttact |
36851823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University