View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20678_high_17 (Length: 227)
Name: NF20678_high_17
Description: NF20678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20678_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 167 - 226
Target Start/End: Complemental strand, 17049364 - 17049306
Alignment:
| Q |
167 |
ttttcatgatcatgagtcttctgaacctcttcatcctcttaattcatgcaataatatcct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
17049364 |
ttttcatgatcatgagtcttctgaacctcttcatcctc-taattcatgcgataatatcct |
17049306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University