View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20678_high_9 (Length: 275)
Name: NF20678_high_9
Description: NF20678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20678_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 28605268 - 28605010
Alignment:
| Q |
1 |
tagcttctgtttcaatttcctttttgggtctgctttgcgccctgctgctgttattgttgactgttgaatgtggattagcaagggagttttgttcaagctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605268 |
tagcttctgtttcaatttcctttttgggtctgctttgcgccctgctgttgttattgttgactgttgaatgtggattagcaagggagttttgttcaagctc |
28605169 |
T |
 |
| Q |
101 |
attcagtggatttcttctgtatggtgattcttctgcttttctcgaggagctgcggctaagtgatgactgacttgttgcattcccatttgctcttgcaggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605168 |
attcagtggatttcttctgtatggtgattcttctgctttcctcgaggagctgcggctaagtgatgactgacttgttgcattcccatttgctcttgcaggc |
28605069 |
T |
 |
| Q |
201 |
gattgagaacgcggtgaaccaacatttctcctaactgtaatcctcttcacaccaattgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605068 |
gattgagaacgcggtgaaccaacatttctcctaactgtaatcctcttcacaccaattgt |
28605010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University