View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20678_low_12 (Length: 260)
Name: NF20678_low_12
Description: NF20678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20678_low_12 |
 | |
|
| [»] scaffold0604 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0604 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0604
Description:
Target: scaffold0604; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 518 - 730
Alignment:
| Q |
18 |
ttatcttgttcacattgtgtgtttttcaacgtgatacgtaatgttattcatatctaatgtgcagtcagatttagataaagattgctggaaaacaacactg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| ||| ||| ||||||||| ||||||| ||||||| |||| |||||||| |||||||| |||| |
|
|
| T |
518 |
ttatgttgttcacattgtgtgtttttcaacatgatacataacgttgttcatatctgatgtgcaatcagattcagattaagattgccggaaaacagcacta |
617 |
T |
|
| Q |
118 |
ttaaagaaatacgacgaatagagacggtggataaagcattcggggtaacacatttaattgcttctttaatggcaatatctcaatatctccatcttcattc |
217 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
618 |
ttaaagaaatacgacgaacatagacggtgggtaaagcattcggggtaacacatttaattgcttcattaatggcaatatctcaatatctccatcttcactc |
717 |
T |
|
| Q |
218 |
aaggtaaattttg |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
718 |
aaggtaaattttg |
730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University