View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20678_low_17 (Length: 227)

Name: NF20678_low_17
Description: NF20678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20678_low_17
NF20678_low_17
[»] chr1 (1 HSPs)
chr1 (167-226)||(17049306-17049364)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 167 - 226
Target Start/End: Complemental strand, 17049364 - 17049306
Alignment:
167 ttttcatgatcatgagtcttctgaacctcttcatcctcttaattcatgcaataatatcct 226  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||    
17049364 ttttcatgatcatgagtcttctgaacctcttcatcctc-taattcatgcgataatatcct 17049306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University