View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20679_low_8 (Length: 246)
Name: NF20679_low_8
Description: NF20679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20679_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 27643199 - 27642977
Alignment:
| Q |
6 |
ctagaatctgactctaaaaatctcttttcttgtagtgtagtctatattactttcagatttacatcttcatatttcactcttacggtgatattaaactcga |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27643199 |
ctagaatctgactctaaacatctcttttcttgtagtgtagtctatattactttcagatttacatcttcatatttcactcttacggtgatattaaactcga |
27643100 |
T |
|
| Q |
106 |
aaagaattgtcatgtcaccaaaaatctgataacatctatgagatcaacctatcaaagaatatggagcatagtctttcaaatcattcatgtttgttctttc |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27643099 |
aaagaattgtcatgtcacc-aaaatctgataacatctatgagatcaacctatcaaagaatatggagcatagtctttcaaatcattcatgtttgttctttc |
27643001 |
T |
|
| Q |
206 |
agacgacgttatctattagaccat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27643000 |
agacgacgttatctattagaccat |
27642977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 94 - 165
Target Start/End: Complemental strand, 13561310 - 13561240
Alignment:
| Q |
94 |
tattaaactcgaaaagaattgtcatgtcaccaaaaatctgataacatctatgagatcaacctatcaaagaat |
165 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||| |||||||||||| ||| ||| | ||||||||| |
|
|
| T |
13561310 |
tattaaactagaaaagaattgtcgtgtcacc-aaaatccgataacatctatatgattaacttgtcaaagaat |
13561240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University