View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2067_high_2 (Length: 285)
Name: NF2067_high_2
Description: NF2067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2067_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 24404503 - 24404241
Alignment:
| Q |
1 |
aatgcttcgtttatgaaacatcaaggacggtgaaggatgtggtcagcgattttcgggtggcttgagattaacttcattacttcccaaagcttcttcgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
24404503 |
aatgcttcgtttatgaaacatcaaggacggtgaaggatgtggtcagcgattttggggtggcttgagattaacttcattacttcccaaagcctgttcgagc |
24404404 |
T |
 |
| Q |
101 |
actttgaatgttggagtggggagatcggtaacaagaaactccataaaggtttttggttaatatggcacgctgggatttggaaatatagaaatgattgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24404403 |
actttgaatgttggagtggggagatccgtaacaagaaactccataaaggtttttggttaatatggcacgctggaatttggaaatctagaaatgattgaat |
24404304 |
T |
 |
| Q |
201 |
ttgtaatgactgcgtgaaggagttggatgagatggtcgaggaaatcaaagtgttgttctggca |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24404303 |
ttgtaatgactgcgtgaaggagttggatgagatggtcgaggaaatcaaagtgttgttctggca |
24404241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 66 - 167
Target Start/End: Complemental strand, 35846659 - 35846557
Alignment:
| Q |
66 |
gattaacttcattacttcccaaagcttcttcgagcactttgaatgtt-ggagtggggagatcggtaacaagaaactccataaaggtttttggttaatatg |
164 |
Q |
| |
|
||||||||||||||| ||||| | || |||||||||||||||| || |||||||||| ||| | ||||||||||| | || ||||||||||||||| || |
|
|
| T |
35846659 |
gattaacttcattacaccccaacgtttgttcgagcactttgaatttttggagtggggaaatccgaaacaagaaacttcgtacaggtttttggttaatttg |
35846560 |
T |
 |
| Q |
165 |
gca |
167 |
Q |
| |
|
||| |
|
|
| T |
35846559 |
gca |
35846557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University