View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2067_high_4 (Length: 274)
Name: NF2067_high_4
Description: NF2067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2067_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 54504906 - 54505173
Alignment:
| Q |
1 |
tcaccatcacctcggtcaactccaattcctcctcctcggaaacgttcaccagtttcaccatcaccatcac------tgtcaaagtcgccttcagtaccct |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
54504906 |
tcaccatcacctcggtcaactccaattcctcatcctcggaaacgttcaccagcttcaccatcaccatcaccatcactgtcaaagtcgccttca---ccct |
54505002 |
T |
 |
| Q |
95 |
cagagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttcagacgagtcaccttcaccggcaccgtcccc |
194 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505003 |
ccgagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttcagacgagtcaccttcaccggcaccgtcccc |
54505102 |
T |
 |
| Q |
195 |
aagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505103 |
aagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
54505173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University