View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2067_high_5 (Length: 265)
Name: NF2067_high_5
Description: NF2067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2067_high_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 265
Target Start/End: Complemental strand, 7864418 - 7864162
Alignment:
| Q |
10 |
aagaatatttctaaaaagaatgcacaacatcgacaaaagtcacaaactttggtnnnnnnnn-tttggtttgaatcttaccaatattcttttgcaggctgg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7864418 |
aagaatatttctaaaaagaatgcacaacatcgacaaaagtcacaaaccttggtaaaaacaaatttggtttgaatcttaccaatattcttttgcaggttgg |
7864319 |
T |
|
| Q |
109 |
tgatagaggtacaaaactttcaggaggtcaaaagcaaagaattgcattggctagagcaatgataaaaaatcctaaaatccttcttttagatgaacctacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7864318 |
tgatagaggtacaaaactttcaggaggtcaaaagcaaagaattgcattggctagagcaatgataaaaaatcctaaaatccttcttttagatgaacctacc |
7864219 |
T |
|
| Q |
209 |
agtgctcttgatgccgagtcagaagctgcagttcaaagggccattgacaagatttca |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7864218 |
agtgctcttgatgccgagtcagaagctgcagttcaaagggccattgacaagatttca |
7864162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University