View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2067_high_7 (Length: 258)
Name: NF2067_high_7
Description: NF2067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2067_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 64 - 245
Target Start/End: Original strand, 410600 - 410781
Alignment:
| Q |
64 |
atttgaaattaatgatttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatgtgttcactgaggagcctcc |
163 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410600 |
atttgaaattaattagttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatgtgttcactgaggagcctcc |
410699 |
T |
|
| Q |
164 |
agccaaagacagtaagttagtgcaacatgagaatgtgattgccactcctcatcttggagccagcaccaaagaagcacaggtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410700 |
agccaaagacagtaagttagtgcaacatgagaatgtgattgctactcctcatcttggagccagcaccaaagaagcacaggtt |
410781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University