View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20680_high_2 (Length: 217)
Name: NF20680_high_2
Description: NF20680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20680_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 197
Target Start/End: Complemental strand, 45727253 - 45727078
Alignment:
| Q |
22 |
aaatgatgattgcattactaggttttttgacaaattacattaggtgggtgattattagaactagttggtgtgcatgtctcatcgacgattcggcagcata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45727253 |
aaatgatgattgcattactaggttttttgacaaattacattaggtgggtgattattagaactagttggtgtgcatgtctcatcgacgattcggcagcata |
45727154 |
T |
 |
| Q |
122 |
acgataatgcgatgcgaggtgccgtgacattaaatattcgataattggggcatcatctctttagagctgttacctc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45727153 |
acgataatgcgatgcgaggtgccgtgacattaaatattcgataataggggcatcatctctttagagctgttacctc |
45727078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University