View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20680_low_2 (Length: 217)

Name: NF20680_low_2
Description: NF20680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20680_low_2
NF20680_low_2
[»] chr1 (1 HSPs)
chr1 (22-197)||(45727078-45727253)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 197
Target Start/End: Complemental strand, 45727253 - 45727078
Alignment:
22 aaatgatgattgcattactaggttttttgacaaattacattaggtgggtgattattagaactagttggtgtgcatgtctcatcgacgattcggcagcata 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45727253 aaatgatgattgcattactaggttttttgacaaattacattaggtgggtgattattagaactagttggtgtgcatgtctcatcgacgattcggcagcata 45727154  T
122 acgataatgcgatgcgaggtgccgtgacattaaatattcgataattggggcatcatctctttagagctgttacctc 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
45727153 acgataatgcgatgcgaggtgccgtgacattaaatattcgataataggggcatcatctctttagagctgttacctc 45727078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University