View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20683_high_2 (Length: 594)
Name: NF20683_high_2
Description: NF20683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20683_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 209 - 346
Target Start/End: Complemental strand, 10759652 - 10759515
Alignment:
| Q |
209 |
ggagaggagatgagaaagtgaaatatgcaataatgtgttaatggtgattcaacataaggaactattagataagagagtcttattgtttgtctattaatta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10759652 |
ggagaggagatgagaaagtgaaatatgcaataatgtgttaatggtgattcaacataaggaactattagataagagagtcttactgtttgtctattaatta |
10759553 |
T |
|
| Q |
309 |
aaagtcagatatttccctaattgaaagctatattattg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10759552 |
aaagtcagatatttccctaattgaaagctatattattg |
10759515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University