View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_high_27 (Length: 251)
Name: NF20685_high_27
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43928115 - 43927904
Alignment:
| Q |
1 |
aacattgggatgatatctgtacaattataaccaattatgtaaaacttaaagcgttgattaaactattcttaaggatttataacataatttacaaaactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43928115 |
aacattgggatgatatctgtacaattataaccaattatgtaa------------------aactattcttaaggatttataacataatttacaaaactta |
43928034 |
T |
 |
| Q |
101 |
atctttatccatgtttcaattatgattataatcataatcatatatatgtaattttgatacaaggattggggtaccaagtaccaactattt-aatgggcgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
43928033 |
atctttatccatgtttcaattatgattataatcataatcatatatatgtaattttgatacaaggattggggtaccaagtaccaactatttaaatgggtgg |
43927934 |
T |
 |
| Q |
200 |
tacatatatatacaaggggtcaaacatcttccgatcattc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43927933 |
----------tacaaggggtcaaacatcttccgatcattc |
43927904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University