View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_high_36 (Length: 230)
Name: NF20685_high_36
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 19 - 176
Target Start/End: Original strand, 50423293 - 50423450
Alignment:
| Q |
19 |
attattagtgtttatctataccgtgacaattataattattgaatgttatgtgaaatgtgtatttgattgtgtgatcttgtgaaattatcatgaatagaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50423293 |
attattagtgtttatctataccgtgacaattataattattgaatgttatgtgaaatgtgtatttgattgtgtgatcttgtgaaattatcgtgaatagaac |
50423392 |
T |
 |
| Q |
119 |
ttattgtgccttagtttagacttaagagtggagtttgtggaggaggtgaaggtaatct |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50423393 |
ttattgtgccttagtttagacttaagagtggagtttgtggaggaggccaaggtaatct |
50423450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 106
Target Start/End: Original strand, 14425772 - 14425825
Alignment:
| Q |
55 |
tattgaatgttatgtgaa--atgtgtatttgattgtgtgatcttgtgaaattat |
106 |
Q |
| |
|
|||||||| ||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
14425772 |
tattgaatattatgtgaagtatatgtatttaattgtgtgatcttgtgaaattat |
14425825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University