View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_low_23 (Length: 271)
Name: NF20685_low_23
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 49511399 - 49511654
Alignment:
| Q |
1 |
ctagttcttccaactcttgctttgtctaaatcaactgttgcatatagacccatcccaataatctgtgaaatgtttttaaatgttgttaggtgttagaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511399 |
ctagttcttccaactcttgctttgtctaaatcaactgttgcatatagacccatcccaataatctgtgaaatgtttttaaatgttgttaggtgttagaatg |
49511498 |
T |
 |
| Q |
101 |
tataaagggaactttatgtgattagaaaaataatgaagtatgttacataattacattacatattatatagtcaacaaggaaataaaataatatgtgaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511499 |
tataaagggaactttatgtgattagaaaaataatgaagtatgttacataattacattacatattatatagtcaacaaggaaataaaataatatgtgaaga |
49511598 |
T |
 |
| Q |
201 |
tatacctctggcttgcattgccattgacaccgaaaacaactcttgacttgtgacag |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49511599 |
tatacctctggcttgcattgccattgacacagaaaacaactcttgacttgtgacag |
49511654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 49522364 - 49522404
Alignment:
| Q |
4 |
gttcttccaactcttgctttgtctaaatcaactgttgcata |
44 |
Q |
| |
|
|||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
49522364 |
gttcgtccaacccttgctttatctaaatcaactgttgcata |
49522404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University