View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_low_26 (Length: 254)
Name: NF20685_low_26
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 72 - 239
Target Start/End: Original strand, 45682087 - 45682253
Alignment:
| Q |
72 |
gaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtccatgggatt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682087 |
gaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtccatgggatt |
45682186 |
T |
 |
| Q |
172 |
atgtgatattaatc-tttgtaggacatacctttaattaagcttatattgttcaggtccaatgcatagtg |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45682187 |
atgtgatattaatcttttgtaggacatacctttaattaagct--tattgttcaggtccaatgcatagtg |
45682253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 45682016 - 45682062
Alignment:
| Q |
1 |
ttataattaatttgtcttatcaatgctgagctgggattgtttatata |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682016 |
ttataattaatttgtcttatcaatgctgagctgggattgtttatata |
45682062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University