View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_low_27 (Length: 253)
Name: NF20685_low_27
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 39 - 235
Target Start/End: Original strand, 12119402 - 12119597
Alignment:
| Q |
39 |
gacgtcacttcaaaatttcttccataagaaatcaaattaacttttttaaatgtgagattgaagtgagaataatcaaattaaactaaacacataatacaaa |
138 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12119402 |
gacgtcactccaaaatttcttacataagaaatcaaattaacttttttaaatgtgagatagaagtgagaata-tcaaattaaactaaacacataatacaaa |
12119500 |
T |
|
| Q |
139 |
ataaataagaagattgagttatgagaaatagttccatacgagggttaaagatttaaagcactttacaattatatgtttcgtatttgaggggtcgtga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| || || |||||||||||||| |
|
|
| T |
12119501 |
ataaataagaagattgagttatgagaaatagtttcatacgagggttaaagatttaaagcactttaccattatatgtctcatacttgaggggtcgtga |
12119597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University