View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_low_36 (Length: 231)
Name: NF20685_low_36
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 8448600 - 8448662
Alignment:
| Q |
1 |
tacctcgacttcactatggagagattgagatttcagttcgaaactgatgaacaaaattgaagt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8448600 |
tacctcgacttcactatggagagattgagattttagttcgaaactgatgaacaaaattgaagt |
8448662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 8236333 - 8236452
Alignment:
| Q |
92 |
acataagaaagatgggtgagattcgttcaatgagatgatgtatttatattactaatgtgacaa-tttatcctcaaaatgagaggttaataaacaagtaat |
190 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| |||||||| | ||| |||| ||| ||||||||| ||| ||||||| |||| ||||||| |
|
|
| T |
8236333 |
acataagaaagatgggtgagattggttccatgagatgatatatttatagtgctagtgtggcaattttatcctc--aataagaggtttataactaagtaat |
8236430 |
T |
|
| Q |
191 |
tagagtcaagtattgatgaact |
212 |
Q |
| |
|
||| ||||||||| ||||||| |
|
|
| T |
8236431 |
taggctcaagtattaatgaact |
8236452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 8448727 - 8448775
Alignment:
| Q |
168 |
tgagaggttaataaacaagtaattagagtcaagtattgatgaacttctt |
216 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
8448727 |
tgagaggctaataaccaagtaattagagtcaagtattaatgaacttctt |
8448775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University