View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20685_low_38 (Length: 210)
Name: NF20685_low_38
Description: NF20685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20685_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 28840857 - 28841034
Alignment:
| Q |
15 |
agagagtgatggtagtagcaagtttgaaggagaagatgtagcaaaatatgtaaaacttttcggttcttgggcagcatcaacaagggtcataataaagtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28840857 |
agagagtgatggtagtagcaagtttgaaggagaagatgtagcaaaatatgtaaaacttttcggttcttgggcagcatcaacaagggtcataataaagtac |
28840956 |
T |
 |
| Q |
115 |
gttgataagagttttgacaatccaacccatccaaaacgttggcttcatacagatgcaaattgagtttggtgttataat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28840957 |
gttgataagagttttgacaatccaacccatccaaaacgttggcttcatacagatgcaaattgagtttggtgttataat |
28841034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 102
Target Start/End: Original strand, 28954789 - 28954846
Alignment:
| Q |
45 |
agaagatgtagcaaaatatgtaaaacttttcggttcttgggcagcatcaacaagggtc |
102 |
Q |
| |
|
|||||||| | ||||||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
28954789 |
agaagatgcaccaaaatatgaaaaacttttttgttcttggagagcatcaacaagggtc |
28954846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University