View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20686_high_2 (Length: 360)
Name: NF20686_high_2
Description: NF20686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20686_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 24 - 145
Target Start/End: Complemental strand, 38644403 - 38644284
Alignment:
| Q |
24 |
tcatcaatatgcagtgcttcatctcttcttcatttttcacttgtttggtccctgaactagaattttccaatgtaaaacacaaccacatcatcttctggga |
123 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
38644403 |
tcatcaatatgcagtgcttcatttcttcttcatttttcacttgtttggtccctgaactagaatttt--aatgtaaaacacaataacatcatcttcaggga |
38644306 |
T |
|
| Q |
124 |
acaagtgtaacaaaattaacaa |
145 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38644305 |
acaagtgtaacaaaattaacaa |
38644284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 259 - 332
Target Start/End: Complemental strand, 38644159 - 38644086
Alignment:
| Q |
259 |
tccctttccgtctacctaagctcactccgaccatttcgattatgattccggttctgagttcccactctgatcct |
332 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38644159 |
tcccttttcgtctacctaagctcactccgaccatttcgattctgattccggttctgagttcccactctgatcct |
38644086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 256
Target Start/End: Complemental strand, 38644206 - 38644173
Alignment:
| Q |
223 |
cgtcgtttgtgtccccaacaaccttcggcggtgg |
256 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
38644206 |
cgtcgtttgtgtccccaacaacctccggcggtgg |
38644173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 69
Target Start/End: Original strand, 39272941 - 39272986
Alignment:
| Q |
24 |
tcatcaatatgcagtgcttcatctcttcttcatttttcacttgttt |
69 |
Q |
| |
|
||||||||||||| ||| | || ||||||||||||||||||||||| |
|
|
| T |
39272941 |
tcatcaatatgcaatgcataatttcttcttcatttttcacttgttt |
39272986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University