View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20686_high_3 (Length: 351)
Name: NF20686_high_3
Description: NF20686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20686_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 30 - 340
Target Start/End: Complemental strand, 47286234 - 47285924
Alignment:
| Q |
30 |
gaagctacaatcatgatctgtgggggagcacctcgaggatcattcgaagctgcaaagggaaagaacttcatgccagcacttaaaacatgtggatttctca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286234 |
gaagctacaatcatgatctgtgggggagcacctcgaggatcattcgaagctgcaaagggaaagaacttcatgccagcacttaaaacatgtggatttctca |
47286135 |
T |
|
| Q |
130 |
aagtaacggattcgaatcctagttggattattgagaatatgccaatggcaagagtaatgggagacatgttaattctacctaacggcgatgttattataat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286134 |
aagtaacggattcgaatcctagttggattattgagaatatgccaatggcaagagtaatgggagacatgttaattctacctaacggcgatgttattataat |
47286035 |
T |
|
| Q |
230 |
taacggcgctggatcaggtacagctggatgggaaaacggatgtcaacctgttttaacaccggtaattttcagttcatcagaaaccaaatcagataaacgg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47286034 |
taacggcgctggatcaggtacagctggatgggaaaacggacgtcaacctgttttaacaccggtaattttccgttcatcagaaaccaaatcagataaacga |
47285935 |
T |
|
| Q |
330 |
tttagtataat |
340 |
Q |
| |
|
|||||| |||| |
|
|
| T |
47285934 |
tttagtgtaat |
47285924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University