View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20687_low_10 (Length: 250)
Name: NF20687_low_10
Description: NF20687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20687_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 43 - 250
Target Start/End: Complemental strand, 35317072 - 35316866
Alignment:
| Q |
43 |
ttaatttactagttgcagctttttaaaatttaggtttttggtcccaagttttacccattattgtaattttagtcatagcccagttatttttactctagaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35317072 |
ttaatttactagttgcagctttttaaaatttaggtttttggtcccaagttttacccattattgtaattttagtcatagcc-agttatttttactctagaa |
35316974 |
T |
|
| Q |
143 |
tggtgatttttgggatagaaagtgttgatttttagcccaaacgtgattttatttttaaattttctcttcaaatttaaaatccgggctaaaaatcacgact |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
35316973 |
tggtgatttttgggatagaaagtgttgatttttagcccaaaagtgattttatttttaaattttctcttcaaatttaaaatacgagctaaaaatcacgact |
35316874 |
T |
|
| Q |
243 |
tttggagc |
250 |
Q |
| |
|
|||||||| |
|
|
| T |
35316873 |
tttggagc |
35316866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 30862005 - 30862246
Alignment:
| Q |
18 |
cttgccattccttaagatatactaattaatttactagttgcagctttttaaaatttaggtttttggtcccaagttttacccattattgtaattttagtca |
117 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30862005 |
cttgtcattctttaagatatactaattaatttactagttgtagctttttaaaatttaggtttttggtcccgagttttacccattattgtaattttagtca |
30862104 |
T |
|
| Q |
118 |
tagcccag-----ttatttttactctagaatggtgatttttgggatagaaagtgttgatttttagcccaaacgtgattttattttt----aaattttctc |
208 |
Q |
| |
|
||||| || || |||||||| |||||||||||||||| |||||||||||| ||||||||| | |||| |||||| | ||||| ||| ||| || |
|
|
| T |
30862105 |
tagccgagtttttttttttttactttagaatggtgattttttggatagaaagtggtgatttttatcacaaaagtgattcttttttttaaaaaaatttatc |
30862204 |
T |
|
| Q |
209 |
ttcaaatttaaaatccgggctaaaaatcacgacttttggagc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30862205 |
ttcaaatttaaaatccgggctaaaaatcacgacttttggagc |
30862246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University