View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20687_low_4 (Length: 345)
Name: NF20687_low_4
Description: NF20687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20687_low_4 |
 | |
|
| [»] scaffold0440 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0440 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0440
Description:
Target: scaffold0440; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 13997 - 14040
Alignment:
| Q |
17 |
tcatcaaatttctgaatcttaatattcaatgtccttattaccag |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13997 |
tcatcaaatttctgaatcttaatattcaatgtccttattaccag |
14040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 25457266 - 25457223
Alignment:
| Q |
17 |
tcatcaaatttctgaatcttaatattcaatgtccttattaccag |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25457266 |
tcatcaaatttctgaatcttaatattcaatgtccttattaccag |
25457223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University