View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20688_high_16 (Length: 359)
Name: NF20688_high_16
Description: NF20688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20688_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 14 - 340
Target Start/End: Original strand, 11022424 - 11022750
Alignment:
| Q |
14 |
gaattaagaaataaaacttggggattaaaactcataattcattttatacttttattcatggaagtttagcagctcaatctaaagaatggaagtttaacag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11022424 |
gaattaagaaataaaacttggggattaaaactcataattcattttatacttttattcatggaagtttagcagctcaatctaaagaatggaagtttttcag |
11022523 |
T |
 |
| Q |
114 |
actttcattctatatggaattatggatggtaagagttaagcaagaagggactgagttatacttgcttacgcaccggcttttccttgaaaaattagcgggt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11022524 |
actttcattctatatggaattatggatggtaagagttaagcaagaaggggctgagttatacttgcttacgcaccggcttttccttgaaaaattagcgggt |
11022623 |
T |
 |
| Q |
214 |
ttgtctcaacctaaagctgttttggtggccaatgatggttggctgactaattaatatgatcaaattttgtcgaccggaacatttgagggttctttttatc |
313 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11022624 |
ttgcctcaacctaaagctgttttggtggccaatgatggttggctgactaattaatatgatcaaattttgtcaaccggaacatttgagggttctttttatc |
11022723 |
T |
 |
| Q |
314 |
ttttacaagatcatactgtgtcaattc |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11022724 |
ttttacaagatcatactgtgtcaattc |
11022750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University