View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20688_low_15 (Length: 361)
Name: NF20688_low_15
Description: NF20688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20688_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 5 - 344
Target Start/End: Complemental strand, 48121606 - 48121267
Alignment:
| Q |
5 |
atgaatactaaccctaaagtctaacctttatttgatctcaatatccaagcaggtgtggaagaattatacatgccaagtttctccattggataattatggc |
104 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48121606 |
atgaatactaacccttaagtctaacctttatttgatctcaatatccaagcaggcgtggaagaattatacatgccaagtttctccattggataattatggt |
48121507 |
T |
 |
| Q |
105 |
acgactggttgcatggctccatacttgtacacacaacttgctactgctgtggaagtggcatatggtttgtatcactatggaccatttttggttgatttaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48121506 |
acgactggttgcatggctccatacttgtacacacaacttgctactgctgtggaagtggcatatggtttgtatcactatggaccatttttggttgatttaa |
48121407 |
T |
 |
| Q |
205 |
tggattgtacttttgttcgaaaaatgttcgtagatattaacaacaactattgtcctggcctagagagatgtactaaatatatttattggggatcaaatgt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48121406 |
tggattgtacttttgttcgaaaaatgttcgtagatattaacaacaactattgtcctggcctagagagatgtactaaatatatttattggggatcaaatgt |
48121307 |
T |
 |
| Q |
305 |
ggtatctgtagctgcagtgttgtccttggtattttggatt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48121306 |
ggtatctgtagctgcagtgttgtccttggtattttggatt |
48121267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University