View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20688_low_28 (Length: 274)
Name: NF20688_low_28
Description: NF20688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20688_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 241
Target Start/End: Original strand, 3189338 - 3189556
Alignment:
| Q |
23 |
taattaataaagaatattgtattggtgatgatggagctagttctagttatgagggtagtaacattattattttgtgcatttggggaattcattgaaggtg |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189338 |
taattaataaagaatattgtattggtggtgatggagctagttctagttatgagggtagtaacattattattttgtgcatttggggaattcattgaaggtg |
3189437 |
T |
 |
| Q |
123 |
aatattgtttggagggaaacaaagataaggcaatggctaacgtgtggagggacttggaactgcttattctccctttcttctcctcttgtttcactatctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189438 |
aatattgtttggagggaaacaaagataaggcaatggctaacgtgtggagggacttggaactgcttattctccctttcttctcctcttgtttcactatctt |
3189537 |
T |
 |
| Q |
223 |
tttcataataatatcaaca |
241 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3189538 |
tttcataataatatcaaca |
3189556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University