View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20688_low_9 (Length: 459)
Name: NF20688_low_9
Description: NF20688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20688_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 6e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 51 - 243
Target Start/End: Complemental strand, 22618137 - 22617945
Alignment:
| Q |
51 |
aaatggatttcacatcctctaagatctcttttcagatcatctcaaaaaccctccttcgcatcatgcccttagtcccacccttatgcattttcatgagtaa |
150 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22618137 |
aaatggattttacatcctctaagatctgttttcagatcatctcaaaaaccctccttcgtatcatgccctcagtcccacccttatgcattttcatgagtaa |
22618038 |
T |
 |
| Q |
151 |
tgaannnnnnnnnggaactgaaggctaaagatcatcctatggccttgaggctgattatagagattaacataccttcctcttttccttcttcgg |
243 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22618037 |
tgaaaaaaaaattggaactgaaagctaaagatcgtcctatggccttgaggctcattatagagattaacataccttcctcttttccttcttcgg |
22617945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 166 - 270
Target Start/End: Original strand, 16594740 - 16594844
Alignment:
| Q |
166 |
aactgaaggctaaagatcatcctatggccttgaggctgattatagagattaacataccttcctcttttccttcttcgggttaccctaaagagtttaaccc |
265 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||| |||||||||| ||||||||||||||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
16594740 |
aactgaaggctaaagatccttttatggccttgaagctcattatagagagtaacataccttcctcttttccttctccgggttactctaaagaatttaaccc |
16594839 |
T |
 |
| Q |
266 |
ccatt |
270 |
Q |
| |
|
|||| |
|
|
| T |
16594840 |
acatt |
16594844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University