View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20689_low_4 (Length: 315)
Name: NF20689_low_4
Description: NF20689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20689_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 8 - 300
Target Start/End: Original strand, 7142783 - 7143075
Alignment:
| Q |
8 |
gttgtcagggtaagacaatcgacgtaccttggtcattttctttctttctaatgctgctttggctaaccgtttcttgctgatcttgggggattgtgattgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7142783 |
gttgtaagggtaagacaatcgacgtaccttggtcattttctttctttctaatgctgctttggctaaccgtttcttgctgatcttgggggattgtgattgt |
7142882 |
T |
|
| Q |
108 |
tcaagaatagaagacccacaaacctgaaagtaaaaacatgcaaaattattgaagacttttatccgaacgagtaaaataaaaattaatcattagtcaaaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7142883 |
tcaagaatagaagacccacaaacctgaaagtaaaaacatgcaaaattattgaagacttttatccgaacgagtaaaataaaaattaatcattagtcaaaca |
7142982 |
T |
|
| Q |
208 |
agaaattaaccatggttgtggatctaggcgtttccctagtcgtttgagcatttggcattaccatcttctctcttggtgcttgatgagaggatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7142983 |
agaaattaaccatggttgtggatctaggcgtttccctagtcgtttgagcatttggcattaccatcttctctcttggtgcttgatgagaggatt |
7143075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 78 - 214
Target Start/End: Original strand, 7161844 - 7161980
Alignment:
| Q |
78 |
ttcttgctgatcttgggggattgtgattgttcaagaatagaagacccacaaacctgaaagtaaaaacatgcaaaattattgaagacttttatccgaacga |
177 |
Q |
| |
|
|||||| ||||||| || ||||| ||||||||| | || ||||||| | ||||||||| || | |||| ||||| ||| | || |||||| | ||| |
|
|
| T |
7161844 |
ttcttgttgatctttggcgattgggattgttcagggatggaagacctaacaacctgaaattacagacatccaaaaagattcaggatttttatacaaacat |
7161943 |
T |
|
| Q |
178 |
gtaaaataaaaattaatcattagtcaaacaagaaatt |
214 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
7161944 |
gtaaaagaaaacttaatcattagtcaaacaaaaaatt |
7161980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University