View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20689_low_5 (Length: 249)
Name: NF20689_low_5
Description: NF20689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20689_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4761721 - 4761956
Alignment:
| Q |
1 |
ttttggactaaaactcattgaaaacaatttagctttatagatgcatcgtagatatttgagccaggagaacccaaaaggaaaatgtggcc--atgttggat |
98 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
4761721 |
ttttggactaaaactcattgaaaacaaattagctttatagatgcatcgtagatatttgagccaggagaacccaaaaggaat---tagctttatgttggat |
4761817 |
T |
 |
| Q |
99 |
tttatcaagaggctaaataattagttaacacttcattgtttaaacagttgnnnnnnnggtgattggccaaataattagtaaacacttcattacatcatct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761818 |
tttatcaagaggctaaataattagttaacacttcattgcttaaacagttgtttttt-ggtgattggccaaataattagtaaacacttcattacatcatct |
4761916 |
T |
 |
| Q |
199 |
tatcggtcataaggtttgactcagctgcaatgctaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761917 |
tatcggtcataaggtttgactcagctgcaatgctaatatt |
4761956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University