View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2068_high_2 (Length: 367)
Name: NF2068_high_2
Description: NF2068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2068_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 7e-65; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 15 - 172
Target Start/End: Complemental strand, 44000851 - 44000695
Alignment:
| Q |
15 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggtagagaaggtgatgatagggttccagcggaggtagagaaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44000851 |
agtatcttcaccggtaacctacacaaaatttcttct-cgagttcagacggaagaatgggtagcgaaggtgatgataggattccagcggaggtagagaaac |
44000753 |
T |
|
| Q |
115 |
gcagcggcatggagcaacagtacgagagaaacagaacggtgaatgttgttataaaaac |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44000752 |
gcagtggcatggagcaacagtacgagagaaacagaacgatgaatgttgttataaaaac |
44000695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 233 - 367
Target Start/End: Complemental strand, 44000697 - 44000563
Alignment:
| Q |
233 |
aactaggatttaggttttataggtaataatcccttaatttgctaatatatattttcaaagaaaaattatttagcataagttgcaccccaatcaaatttta |
332 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| ||||| ||| ||||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
44000697 |
aactagggtttaggttttataggtgataatcccttaaattgctcatacatattttcaaagaaaaaatatttagcataagtttcaacccaatcaaatttta |
44000598 |
T |
|
| Q |
333 |
atcccaaaaaatatcttacggggaacacaccaatt |
367 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |
|
|
| T |
44000597 |
atcccaaaaaatatctatcggggaacacaacaatt |
44000563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 43996873 - 43996812
Alignment:
| Q |
15 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggtag |
76 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
43996873 |
agtatcttcaccggtaacctgcacaatatttcttccacaagttcagaccgaagagtaggtag |
43996812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 43991293 - 43991233
Alignment:
| Q |
15 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggta |
75 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
43991293 |
agtatcttcaccggtaatctacacaggatttcttccacaagttcaaacggaagagtgggta |
43991233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University