View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2068_low_3 (Length: 293)
Name: NF2068_low_3
Description: NF2068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2068_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 115 - 281
Target Start/End: Original strand, 5751827 - 5751993
Alignment:
| Q |
115 |
tgacatgcagctgactgctgaggcttacgatgtgttgaagtcagttggaaagttgacaaatgaggagctacaaagtgcatttactgaatggaacaaggga |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5751827 |
tgacatgcagctgattgctgaggcttacgatgtgttgaagtcagttggaaagttgacaaacgaggagctacaaagtgcatttaccgaatggaacaaggga |
5751926 |
T |
|
| Q |
215 |
gaacttttgggtttcctgattgaaatcacagcagatatattcggaattaaggatgataaggatgatg |
281 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5751927 |
gaacttttgagtttcctaattgaaatcactgcagatatattcggaattaaggatgataagggtgatg |
5751993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 5717153 - 5717207
Alignment:
| Q |
42 |
tagattatttacaaataaaagagggttacaatttctatatatttgtagtgcttat |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
5717153 |
tagattatttacaaataaaacagggttacttgttctatatatttgtactgcttat |
5717207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University