View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2068_low_7 (Length: 236)
Name: NF2068_low_7
Description: NF2068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2068_low_7 |
 | |
|
| [»] scaffold0154 (1 HSPs) |
| | |
|
| [»] scaffold0189 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0154 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 97 - 215
Target Start/End: Complemental strand, 22235 - 22117
Alignment:
| Q |
97 |
aattattaccaatgtctgtatatataccaatgttactgttatgtttgtggtgtgtgtcggtacatgcttgatagattaagacccataaagttttaataac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22235 |
aattattaccaatgtctgtatatataccaatgttactgttatgtttgtggtgtgtgtcggtacatgcttgatagattaagacccataaagttttaataac |
22136 |
T |
|
| Q |
197 |
cggaataaaaatcccacgt |
215 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
22135 |
cggaataaaaatcccacgt |
22117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 9348 - 9399
Alignment:
| Q |
162 |
gcttgatagattaagacccataaagttttaataaccggaataaaaatcccac |
213 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
9348 |
gcttgatagattaagacccgtaaagttgtaataaccgaaataaaaatcccac |
9399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University