View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20690_high_5 (Length: 351)
Name: NF20690_high_5
Description: NF20690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20690_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 14 - 340
Target Start/End: Complemental strand, 41074225 - 41073900
Alignment:
| Q |
14 |
aatatcactcttcctatcaaatatcgggacattacaactctcaatgtcaccaatggaaaaggaaaaattagtgatgaatatttatgattgaaaaaattaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074225 |
aatatcactcttcctatcaaatatcgggacattacaactctcaatgtcaccaatggaaaaggaaaaattagtgatgaatatttatgattgaaaaaattaa |
41074126 |
T |
 |
| Q |
114 |
atctctcactaatctacttatttcactcttaagcaagccatgacttaaaacttctaagcctatgacctaggacacaagtaatgatttgagaaggatga-- |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074125 |
atctctcactaatctacttatttcactcttaagcaagccatgacttaaaacttctaagcgtatgacctaggacacaagtaatgatttgagaaggatgatg |
41074026 |
T |
 |
| Q |
212 |
-tgatctatgaagtacggaagcttcttagattaggcgtgtccggtgttggacatgtat-gtgtctggcaccaacacgtataattacagtgaattctaaaa |
309 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |||||| |||||||||||||| |||||||||||||| |
|
|
| T |
41074025 |
atgatctatgaagtacggacgcttcttagattagacgtgtccggtgttggatatgtatcatgtctgacaccaacacgtata-----agtgaattctaaaa |
41073931 |
T |
 |
| Q |
310 |
attattagctacctgaatggtgtcttcttct |
340 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
41073930 |
attatttgctacctgaatggtgtcttcttct |
41073900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 145
Target Start/End: Complemental strand, 41074429 - 41074387
Alignment:
| Q |
103 |
gaaaaaattaaatctctcactaatctacttatttcactcttaa |
145 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41074429 |
gaaaaaattaaatctctcacaattctacttatttcactcttaa |
41074387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University