View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20691_high_20 (Length: 316)
Name: NF20691_high_20
Description: NF20691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20691_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 87 - 230
Target Start/End: Original strand, 3151149 - 3151292
Alignment:
| Q |
87 |
aagattacttgaatttctttgcaggaaaatgtgccaattgaggaagtgtttcaaactttgaggtgtgattcaaatggactcacaacaaaggctgctgagg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151149 |
aagattacttgaatttctttgcaggaaaatgtgccaattgaggaagtgtttcaaactttgaggtgtgattcaaatggactcacaacaaaggctgctgagg |
3151248 |
T |
|
| Q |
187 |
agagattggctatctttggtcacaacaaacttgaggagaagcag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151249 |
agagattggctatctttggtcacaacaaacttgaggagaagcag |
3151292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University