View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20691_low_22 (Length: 340)
Name: NF20691_low_22
Description: NF20691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20691_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 27895424 - 27895235
Alignment:
| Q |
14 |
ttcttattgcaggatcttcctgaagcagtatcatctgaagaactagctcggtatctagatttaaagaagctggacgaaagagtctacatgtttgaagccg |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27895424 |
ttcttattgcaggatctccctgaagcagtatcatctgaagaactagctcggtatctagatttaaagaagctggacgaaagagtctacatgtttgaagccg |
27895325 |
T |
 |
| Q |
114 |
tgtcatcatatgatgggtaagtgagaggttgtataaactttttaaatcttaagggggcacagacccttgaagttctgtgttattgtcctg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27895324 |
tgtcatcatatgatgggtaagtgagaggttgtataaactttttaaatcttaagggggcacagacccttgaagttctgtgttattgtcctg |
27895235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 202 - 320
Target Start/End: Complemental strand, 27895163 - 27895045
Alignment:
| Q |
202 |
tgcaggctggggatcagggaaagtgcagaatggcttgtggaagtaatggagagaagcaagagggctgaaatgttgagattgcgagcaggtgcaatgggtc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27895163 |
tgcaggctggggatcagggaaagtgcagaatggcttgtggaagtaatggagagaagcaagagggctgaaatgttgagattgtgagcaggtgcaatgggtc |
27895064 |
T |
 |
| Q |
302 |
caggtcctgcctagaggtc |
320 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27895063 |
caggtcctgcctagaggtc |
27895045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 7628046 - 7627895
Alignment:
| Q |
14 |
ttcttattgcaggatcttcctgaagcagtatcatctgaagaactagctcggtatctagatttaaagaagctggacgaaagagtctacatgtttgaagccg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7628046 |
ttcttattgcaggatcttcctgaagcagtatcatctgaagaactagctcggtatctagatttaaagaagctggacgaaagagtctacatgtttgaagccg |
7627947 |
T |
 |
| Q |
114 |
tgtcatcatatgatgggtaagtgagaggttgtataaactttttaaatcttaa |
165 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
7627946 |
tgtcagcatatgatgggtaagtgagaggttatataaacttttcaaatcttaa |
7627895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 202 - 322
Target Start/End: Complemental strand, 7627511 - 7627391
Alignment:
| Q |
202 |
tgcaggctggggatcagggaaagtgcagaatggcttgtggaagtaatggagagaagcaagagggctgaaatgttgagattgcgagcaggtgcaatgggtc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7627511 |
tgcaggctggggatcagggaaagtgcagaatggcttgtggaagtgatggaacgaagcaagaggactgaaatgttgagattgcgggcaggtgcaatgggtc |
7627412 |
T |
 |
| Q |
302 |
caggtcctgcctagaggtcct |
322 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7627411 |
caggtcctgcctagaggtcct |
7627391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 7627623 - 7627582
Alignment:
| Q |
165 |
agggggcacagacccttgaagttctgtgttattgtcctgcag |
206 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7627623 |
agggggcaaagaaccttgaagttctgtgttattgtcctgcag |
7627582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University