View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20691_low_3 (Length: 616)
Name: NF20691_low_3
Description: NF20691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20691_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 4e-46; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 264 - 404
Target Start/End: Complemental strand, 5427222 - 5427085
Alignment:
| Q |
264 |
gggtaagttggatgaaaaatatatttaatactgattgcctaattttacgtggggtgttttaactttaaactaagacataaaagctgatatgataatttga |
363 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
5427222 |
gggtaagttcgatgaaaaatatatttaatactgattgcctaaatttatgttgggtgttttaactttaaactaa---aaaaaagctgatatgatgatttga |
5427126 |
T |
 |
| Q |
364 |
gtttagcatcaaagaaactaaataatcaagaaacgggccat |
404 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
5427125 |
gtttagcatcaaagaaactacataatcaagaaatgggccat |
5427085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 5419027 - 5418950
Alignment:
| Q |
49 |
tactttactgtttatttcttgtaatttggttccttagataaataaagttcttgtgatttggtcttctgtttgtcatct |
126 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419027 |
tactttacggtttagttcttgtaatttggttccttagataaaaaaagttcttgtgatttggtcttctgtttgtcatct |
5418950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 51 - 113
Target Start/End: Complemental strand, 5427428 - 5427366
Alignment:
| Q |
51 |
ctttactgtttatttcttgtaatttggttccttagataaataaagttcttgtgatttggtctt |
113 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
5427428 |
ctttacggtttagttcttgtaatttggttccttagaaaataaaagttcttgtgatttggtctt |
5427366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University