View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20692_low_25 (Length: 249)
Name: NF20692_low_25
Description: NF20692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20692_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 33345208 - 33344976
Alignment:
| Q |
1 |
attgtttttgcaatcaacaagcaagttgaatcttgtagtaccgaaagtccgaaacagacaaaaaccgaaaaaccgcaaatgttattacattcaacaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33345208 |
attgtttttgcaatcaacaagcaagttgaatcttgtagtaccgaaagtccgaaacagacaaaaaccg--------caaatgttattacattcaacaattg |
33345117 |
T |
|
| Q |
101 |
cttctgttttctcaaattattaccattgccacgtgtctggtattcgtgtctgtgtcacagtttcatagagttgaataggtgtaactcaatcaattacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33345116 |
cttctgttttctcaaattattaccattgccacatgtctggtattcgtgtctgtgtcacagtttcatagagttgaataggtgtaactcaatcaattacttt |
33345017 |
T |
|
| Q |
201 |
tactaactgatttataaagaaaataatttgtcaatattctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33345016 |
tactaactgatttataaagaaaataatttgtcaatattctt |
33344976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University