View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20692_low_26 (Length: 249)
Name: NF20692_low_26
Description: NF20692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20692_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 50613317 - 50613080
Alignment:
| Q |
1 |
tgatcagatttaccaaaatttgaatcaacttagagtgtgcaatctatgattgtaaatttattagagaaacaataatatatacatagaaatcttaagagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50613317 |
tgatcagatttaccaaaatttgaatcaacttagagtgtgcaatctatgattgtaaatttattagagaaacaataaaatatacatagaaatcttaagagaa |
50613218 |
T |
 |
| Q |
101 |
agttagtatggataagtttttcacgaaagtcatgaatgtctagctgtgaattttgtatatgatagnnnnnnncaatgctatagattgcaagacaaaacat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
50613217 |
atttagtatggataagtttttcacgaaagtcatgaatgtctagctgtgaattttgtatatgatagaaaaaaacaatgctatagattgcaagaaaaaacat |
50613118 |
T |
 |
| Q |
201 |
aacgaatgcttagcgacaaactatgatcggttgattca |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50613117 |
aacgaatgcatagcgacaaactatgatcggttgattca |
50613080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University