View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20693_low_6 (Length: 205)
Name: NF20693_low_6
Description: NF20693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20693_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 34960324 - 34960508
Alignment:
| Q |
1 |
taatttaaaataaaatcataaccggaaattaaatatcctacaacaatcgtagaggatctaattcaaatgcaattgggcatgagcatctatagcatcatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34960324 |
taatttaaaataaaatcataaccggaaattaaatatcctacaacaattgtaggggatctaattcaaatgcaattgggcatgagcatctatagcatcatgc |
34960423 |
T |
|
| Q |
101 |
tttaagcccccacagatgatgctaaagtaatagtgatattttgctggcttattttcccaactataatgatagcatagcacacgtt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34960424 |
tttaagcccccacagatgatgctaaagtaatagtgatattttgctggcttattttcccaactataatgatagcatagcacacgtt |
34960508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University