View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_high_11 (Length: 365)
Name: NF20695_high_11
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 19 - 357
Target Start/End: Complemental strand, 42217208 - 42216870
Alignment:
| Q |
19 |
atattgcactgcatagtgcatacaaatgcaaggttgatttgatttaaacttgttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217208 |
atattgcactgcatagtgcatacaaatgcaaggttgatttgatttaaacttgttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacc |
42217109 |
T |
|
| Q |
119 |
catctggtccaaccatcgagaacccaagtccggttgatgatcagggccatggcactcacacttcgtcgacagcggctggatcagtggtgaggggtgcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
42217108 |
catctggtccaaccatcgagaacccaagtccggtggatgatcagggccatggcactcacacttcgtcgacagcagctggatcagtggtgagaggtgcaag |
42217009 |
T |
|
| Q |
219 |
tctttatggcattggtaaaggcaatgcccgtggcggtgtcccatcagcacgtattgcaatgtataaagtttgttggaccattgggtgcagtgacatggac |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217008 |
tctttatggcattggtaaaggcaatgcccgtggcggtgtcccatcagcacgcattgcaatgtataaagtttgttggaccattgggtgcagtgacatggac |
42216909 |
T |
|
| Q |
319 |
atgcttgctggctttgatgaggccattgctgatgatgtc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42216908 |
atgcttgctggctttgatgaggccattgctgatggtgtc |
42216870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University