View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_high_15 (Length: 315)
Name: NF20695_high_15
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 195 - 300
Target Start/End: Original strand, 46937950 - 46938055
Alignment:
| Q |
195 |
aagttatttccatacatacgacgtgaatgggaaattattcaagatccttctatttatgtgaaatgatgagatactttgcctcgtatcatcgaataagaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46937950 |
aagttatttccatacatacgacgtgaatgggaaattattcaagatccttctatttatgtgaaatgatgagatactttgcctcgtatcatcgaataagaat |
46938049 |
T |
 |
| Q |
295 |
agaagt |
300 |
Q |
| |
|
|||||| |
|
|
| T |
46938050 |
agaagt |
46938055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 46937755 - 46937869
Alignment:
| Q |
1 |
atagtatgacctatatactctatgatcaaatgcatggcatgacaaatttctaannnnnnnnnnnaagatactttatagttacattaaaaggagagaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46937755 |
atagtatgacctatatactctatgatcaaatgcatggcatgacaaatttctattttttttttttaagatactttatagttacattaaaaggagagaattg |
46937854 |
T |
 |
| Q |
101 |
aacaacaacggaggt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46937855 |
aacaacaacggaggt |
46937869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University