View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_high_23 (Length: 252)
Name: NF20695_high_23
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 24820278 - 24820140
Alignment:
| Q |
1 |
tttactcattttaaaagaaaattagtagtacccattaaaatctaactctatgacattaaatctcgttatagtacagtcttgtgcattcatgtttaatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24820278 |
tttactcattttaaaagaaaattagtagtacccattaaaatctaactctatgacattaaatctcgttatagtacagtcttgtgcattcatgttcaatttc |
24820179 |
T |
 |
| Q |
101 |
caagatgataattttagtaaagaaaatggaaccaagact |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820178 |
caagatgataattttagtaaagaaaatggaaccaagact |
24820140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 246
Target Start/End: Complemental strand, 24820079 - 24820040
Alignment:
| Q |
207 |
ggagaattagtgaagaaaatcatgttgaaagtataatcta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820079 |
ggagaattagtgaagaaaatcatgttgaaagtataatcta |
24820040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University