View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_high_32 (Length: 235)
Name: NF20695_high_32
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 41625396 - 41625272
Alignment:
| Q |
97 |
cagaacaattaacacttgattgataagttatttgctttattttgaattttccaataaaatatcactttaagtttagtaaaatgcttctttctctcgtaag |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41625396 |
cagaacaattatcacttgattgataagttatttgctttattttgaattttccaataaaatatcactttaagtttagtaaaatgcttctttctctcgtaag |
41625297 |
T |
|
| Q |
197 |
ctaatggttcttattagagataagt |
221 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
41625296 |
ccaatggttcttattagagataagt |
41625272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 41625487 - 41625424
Alignment:
| Q |
1 |
cacaccaaacacacactataacaaacatgctcatatttaactatctcaaacaagtttattagtg |
64 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41625487 |
cacatcaaacacacactataacaaacatgctcatatttaactatctcaaacaagtttattagtg |
41625424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University