View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_low_13 (Length: 326)
Name: NF20695_low_13
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 45 - 258
Target Start/End: Original strand, 8475441 - 8475664
Alignment:
| Q |
45 |
catgttatgaatcatcatgataaaaatataattctctcatttttattctcaaaccgtcaatcccgcgataagcccataatcagcttgactagttactttt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8475441 |
catgttatgaatcatcatgataaaaatataattctctcatttttattctcaaaccgtcaatcccgcgataagcccataatcagcttgactagttactttt |
8475540 |
T |
 |
| Q |
145 |
tataaatgtacaaagttcaacattaatggtttttataaaatacgatcagatcgaga----------aaaataaaatacatacaaatggtcaattttgtta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8475541 |
tataaatgtacaaagttcaacattaatggtttttataaaatacgatcagatcgagaaaaataaaataaaataaaatacatacaaatggtcaattttgtta |
8475640 |
T |
 |
| Q |
235 |
tggtttacttccttgatgcaagtc |
258 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8475641 |
tggtttacttccttgatgcaagtc |
8475664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University